Home / Products /Genome Editing /gRNA plasmids /hCDC42BPA gRNA1 KO plasmidhCDC42BPA gRNA2 KO plasmidhCDC42BPA gRNA3 KO plasmid

hCDC42BPA gRNA1 KO plasmidhCDC42BPA gRNA2 KO plasmidhCDC42BPA gRNA3 KO plasmid

Catalog Number: GP06399

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCDC42BPA gRNA1 KO plasmidhCDC42BPA gRNA2 KO plasmidhCDC42BPA gRNA3 KO plasmid
gRNA sequence AGAAGTGCGTTTGAGGCAGTTGG(70,0.67),CATTCTCGAATACCTAGAATGGG(79,0.62),GCACTGCCCATTGGTCTGAGCGG(69,0.75)
Gene hCDC42BPA
Gene ID 8476
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.