Home / Products /Genome Editing /gRNA plasmids /hCDC25A gRNA1 KO plasmidhCDC25A gRNA2 KO plasmidhCDC25A gRNA3 KO plasmid

hCDC25A gRNA1 KO plasmidhCDC25A gRNA2 KO plasmidhCDC25A gRNA3 KO plasmid

Catalog Number: GP05582

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCDC25A gRNA1 KO plasmidhCDC25A gRNA2 KO plasmidhCDC25A gRNA3 KO plasmid
gRNA sequence CGCGTCGCAGCCCGTCGTGAAGG(98,0.69),TTTGGCGCTTCAGCCGCCGGGGG(96,0.89),CGTCACTATGGACCAGCTGCAGG(80,0.65)
Gene hCDC25A
Gene ID 993
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.