Home / Products /Genome Editing /gRNA plasmids /hCD36 gRNA1 KO plasmidhCD36 gRNA2 KO plasmidhCD36 gRNA3 KO plasmid

hCD36 gRNA1 KO plasmidhCD36 gRNA2 KO plasmidhCD36 gRNA3 KO plasmid

Catalog Number: GP05597

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCD36 gRNA1 KO plasmidhCD36 gRNA2 KO plasmidhCD36 gRNA3 KO plasmid
gRNA sequence CGGAACTGTGGGCTCATCGCTGG(93,0.65),GGAGGTATTCTAATGCCAGTTGG(82,0.72),GGCTGTCATTGGTGCTGTCCTGG(70,0.62)
Gene hCD36
Gene ID 948
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.