Home / Products /Genome Editing /gRNA plasmids /hCCT6A gRNA1 KO plasmidhCCT6A gRNA2 KO plasmidhCCT6A gRNA3 KO plasmid

hCCT6A gRNA1 KO plasmidhCCT6A gRNA2 KO plasmidhCCT6A gRNA3 KO plasmid

Catalog Number: GP01195

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCCT6A gRNA1 KO plasmidhCCT6A gRNA2 KO plasmidhCCT6A gRNA3 KO plasmid
gRNA sequence CGGTCAACATCAGCGCAGCG
Gene hCCT6A
Gene ID 908
Fluorescence/resistance EGFP/puro
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.