Home / Products /Genome Editing /gRNA plasmids /hCAPN1 gRNA1 KO plasmidhCAPN1 gRNA2 KO plasmidhCAPN1 gRNA3 KO plasmid

hCAPN1 gRNA1 KO plasmidhCAPN1 gRNA2 KO plasmidhCAPN1 gRNA3 KO plasmid

Catalog Number: GP05639

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCAPN1 gRNA1 KO plasmidhCAPN1 gRNA2 KO plasmidhCAPN1 gRNA3 KO plasmid
gRNA sequence GTCGGAGGAGATCATCACGCCGG(92,0.74),TGGGACCCTCTTCCGTGATGAGG(90,0.69),GACACCCCAGTGCAGTACACCGG(84,0.67)
Gene hCAPN1
Gene ID 823
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.