Home / Products /Genome Editing /gRNA plasmids /hCAMKK2 gRNA1 KO plasmidhCAMKK2 gRNA2 KO plasmidhCAMKK2 gRNA3 KO plasmid

hCAMKK2 gRNA1 KO plasmidhCAMKK2 gRNA2 KO plasmidhCAMKK2 gRNA3 KO plasmid

Catalog Number: GP08231

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCAMKK2 gRNA1 KO plasmidhCAMKK2 gRNA2 KO plasmidhCAMKK2 gRNA3 KO plasmid
gRNA sequence TTGCAGAGACAGCTTGCGACCGG(92,0.67),GCCGGTCCCGCGCCAAGCCGAGG(88,0.8),TGGGACCCGGAGGTGTCAAGGGG(84,0.75)
Gene hCAMKK2
Gene ID 10645
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.