Home / Products /Genome Editing /gRNA plasmids /hC9orf78 gRNA1 KO plasmidhC9orf78 gRNA2 KO plasmidhC9orf78 gRNA3 KO plasmid

hC9orf78 gRNA1 KO plasmidhC9orf78 gRNA2 KO plasmidhC9orf78 gRNA3 KO plasmid

Catalog Number: GP05657

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hC9orf78 gRNA1 KO plasmidhC9orf78 gRNA2 KO plasmidhC9orf78 gRNA3 KO plasmid
gRNA sequence GGAAGATTTTCCGTCGCCGCCGG(99,0.7),CCTCTGACTCCGAGTCGCCCCGG(90,0.76),CTTGAGGAAGAGGCCCAACGGGG(79,0.79)
Gene hC9orf78
Gene ID 51759
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.