Home / Products /Genome Editing /gRNA plasmids /hC5orf51 gRNA1 KO plasmidhC5orf51 gRNA2 KO plasmidhC5orf51 gRNA3 KO plasmid

hC5orf51 gRNA1 KO plasmidhC5orf51 gRNA2 KO plasmidhC5orf51 gRNA3 KO plasmid

Catalog Number: GP05660

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hC5orf51 gRNA1 KO plasmidhC5orf51 gRNA2 KO plasmidhC5orf51 gRNA3 KO plasmid
gRNA sequence GGCGGCCGCAGTCTCTAGTGTGG(89,0.78),CTTCGCTAAGTTGCTGTATGTGG(85,0.78),AGTGGAAGAGCTCGGGGATCTGG(82,0.66)
Gene hC5orf51
Gene ID 285636
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.