Home / Products /Genome Editing /gRNA plasmids /hBRD3 gRNA1 KO plasmidhBRD3 gRNA2 KO plasmidhBRD3 gRNA3 KO plasmid

hBRD3 gRNA1 KO plasmidhBRD3 gRNA2 KO plasmidhBRD3 gRNA3 KO plasmid

Catalog Number: GP05680

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hBRD3 gRNA1 KO plasmidhBRD3 gRNA2 KO plasmidhBRD3 gRNA3 KO plasmid
gRNA sequence CCCCGCGGGGGCGACTGTCGTGG(93,0.86),TGTGAACCCACCCCCCCCGGAGG(86,0.79),GTCTTGCGGCCGGGCTTGCTGGG(85,0.65)
Gene hBRD3
Gene ID 8019
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.