Home / Products /Genome Editing /gRNA plasmids /hB4GALT1 gRNA1 KO plasmidhB4GALT1 gRNA2 KO plasmid

hB4GALT1 gRNA1 KO plasmidhB4GALT1 gRNA2 KO plasmid

Catalog Number: GP05724

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hB4GALT1 gRNA1 KO plasmidhB4GALT1 gRNA2 KO plasmid
gRNA sequence CAGGCGGCAGGCCCGCTGTAGGG(93,0.68),ACCCTCGTTTACTACCTGGCTGG(91,0.66)
Gene hB4GALT1
Gene ID 2683
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.