Home / Products /Genome Editing /gRNA plasmids /hATXN2L gRNA1 KO plasmidhATXN2L gRNA2 KO plasmidhATXN2L gRNA3 KO plasmid

hATXN2L gRNA1 KO plasmidhATXN2L gRNA2 KO plasmidhATXN2L gRNA3 KO plasmid

Catalog Number: GP05729

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hATXN2L gRNA1 KO plasmidhATXN2L gRNA2 KO plasmidhATXN2L gRNA3 KO plasmid
gRNA sequence CTTGAAGATACCCTCATAAGTGG(86,0.71),TTTCCGGTGCACAGCATCCACGG(82,0.67),TCCCGACGAGGGCCACCTGCTGG(65,0.72)
Gene hATXN2L
Gene ID 11273
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.