Home / Products /Genome Editing /gRNA plasmids /hATG10 gRNA1 KO plasmidhATG10 gRNA2 KO plasmid

hATG10 gRNA1 KO plasmidhATG10 gRNA2 KO plasmid

Catalog Number: GP05756

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hATG10 gRNA1 KO plasmidhATG10 gRNA2 KO plasmid
gRNA sequence TGAATTCTGCACAATAACGTTGG(87,0.7),AGATAGGTGATAGTTGGGAATGG(69,0.64)
Gene hATG10
Gene ID 83734
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.