Home / Products /Genome Editing /gRNA plasmids /hARFIP1 gRNA1 KO plasmidhARFIP1 gRNA2 KO plasmidhARFIP1 gRNA3 KO plasmid

hARFIP1 gRNA1 KO plasmidhARFIP1 gRNA2 KO plasmidhARFIP1 gRNA3 KO plasmid

Catalog Number: GP07682

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hARFIP1 gRNA1 KO plasmidhARFIP1 gRNA2 KO plasmidhARFIP1 gRNA3 KO plasmid
gRNA sequence CAAAGCCATGAGATGTAATTTGG(72,0.7),AAAGAGGGTGTTATTGAAGCAGG(72,0.67),CATTCATTACCATCTGGACTTGG(75,0.6)
Gene hARFIP1
Gene ID 27236
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.