Home / Products /Genome Editing /gRNA plasmids /mP2ry12 KO gRNA1 plasmidmP2ry12 KO gRNA2 plasmidmP2ry12 KO gRNA3 plasmid

mP2ry12 KO gRNA1 plasmidmP2ry12 KO gRNA2 plasmidmP2ry12 KO gRNA3 plasmid

Catalog Number: GP02251

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name mP2ry12 KO gRNA1 plasmidmP2ry12 KO gRNA2 plasmidmP2ry12 KO gRNA3 plasmid
gRNA sequence CTTGTAGTCTCTGACGCACAGGG(91,0.71),ACAGGACGGTGTACAGCAATGGG(89,0.65),GCTGAGGTGGTGTTGACACCAGG(76,0.72)
Gene mP2ry12
Gene ID 70839
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.