Home / Products /Genome Editing /gRNA plasmids /hUSP2 gRNA1 KO plasmidhUSP2 gRNA2 KO plasmid

hUSP2 gRNA1 KO plasmidhUSP2 gRNA2 KO plasmid

Catalog Number: GP03686

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hUSP2 gRNA1 KO plasmidhUSP2 gRNA2 KO plasmid
gRNA sequence GTAGGCACCATAGCCCGACTTGG(94,0.76),TAAAGGCCGCTCAGTACCCCGGG(91,0.7)
Gene hUSP2
Gene ID 9099
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.