Home / Products /Genome Editing /gRNA plasmids /hUSB1 gRNA1 KO plasmidhUSB1 gRNA2 KO plasmid

hUSB1 gRNA1 KO plasmidhUSB1 gRNA2 KO plasmid

Catalog Number: GP03695

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hUSB1 gRNA1 KO plasmidhUSB1 gRNA2 KO plasmid
gRNA sequence ATGAGCGCGGCGCCCCTGGTGGG(92,0.71),ATGAGTCCGAGGACGGGATGCGG(88,0.74)
Gene hUSB1
Gene ID 79650
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.