Home / Products /Genome Editing /gRNA plasmids /hUFSP2 gRNA1 KO plasmidhUFSP2 gRNA2 KO plasmid

hUFSP2 gRNA1 KO plasmidhUFSP2 gRNA2 KO plasmid

Catalog Number: GP03705

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hUFSP2 gRNA1 KO plasmidhUFSP2 gRNA2 KO plasmid
gRNA sequence CTAGCTGAAAAGCCAAATCAAGG(69,0.65),ATACTCTTCAGAATAAGAGGAGG(69,0.72)
Gene hUFSP2
Gene ID 55325
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.