Home / Products /Genome Editing /gRNA plasmids /hTUBB2A gRNA1 KO plasmidhTUBB2A gRNA2 KO plasmid

hTUBB2A gRNA1 KO plasmidhTUBB2A gRNA2 KO plasmid

Catalog Number: GP03738

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTUBB2A gRNA1 KO plasmidhTUBB2A gRNA2 KO plasmid
gRNA sequence CTGGCACCATGGACTCTGTCAGG(80,0.65),ATATGTACCTCGGGCCATCCTGG(61,0.69)
Gene hTUBB2A
Gene ID 7280
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.