Home / Products /Genome Editing /gRNA plasmids /hTSC2 gRNA1 KO plasmidhTSC2 gRNA2 KO plasmid

hTSC2 gRNA1 KO plasmidhTSC2 gRNA2 KO plasmid

Catalog Number: GP06631

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTSC2 gRNA1 KO plasmidhTSC2 gRNA2 KO plasmid
gRNA sequence CCTTTCGTGAAGGTCTTCGTTGG(95,0.75),TCAAGGCCCTCACAGACAATGGG(77,0.75)
Gene hTSC2
Gene ID 7249
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.