Home / Products /Genome Editing /gRNA plasmids /hTRIM14 gRNA1 KO plasmidhTRIM14 gRNA2 KO plasmidhTRIM14 gRNA3 KO plasmid

hTRIM14 gRNA1 KO plasmidhTRIM14 gRNA2 KO plasmidhTRIM14 gRNA3 KO plasmid

Catalog Number: GP06163

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTRIM14 gRNA1 KO plasmidhTRIM14 gRNA2 KO plasmidhTRIM14 gRNA3 KO plasmid
gRNA sequence AAAGCGCGCACACGCAGCGGCGG(94,0.79),CCCGGAGCATGGCGACCGCGTGG(92,0.65),AGCTTGTCGAGGGATGCGGCTGG(89,0.7)
Gene hTRIM14
Gene ID 9830
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.