Home / Products /Genome Editing /gRNA plasmids /hTP63 gRNA1 KO plasmidhTP63 gRNA2 KO plasmid

hTP63 gRNA1 KO plasmidhTP63 gRNA2 KO plasmid

Catalog Number: GP06362

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTP63 gRNA1 KO plasmidhTP63 gRNA2 KO plasmid
gRNA sequence AGCCCCAGGTTCGTGTACTGTGG(85,0.75),GTTATAGGGACTGGTGGACGAGG(83,0.67)
Gene hTP63
Gene ID 8626
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.