Home / Products /Genome Editing /gRNA plasmids /hTP53 gRNA1 KO plasmidhTP53 gRNA2 KO plasmidhTP53 gRNA3 KO plasmid

hTP53 gRNA1 KO plasmidhTP53 gRNA2 KO plasmidhTP53 gRNA3 KO plasmid

Catalog Number: GP03497

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTP53 gRNA1 KO plasmidhTP53 gRNA2 KO plasmidhTP53 gRNA3 KO plasmid
gRNA sequence CCATTGTTCAATATCGTCCG
Gene hTP53
Gene ID 7157
Fluorescence/resistance Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.