Home / Products /Genome Editing /gRNA plasmids /hTOP2B gRNA1 KO plasmidhTOP2B gRNA2 KO plasmid

hTOP2B gRNA1 KO plasmidhTOP2B gRNA2 KO plasmid

Catalog Number: GP06648

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTOP2B gRNA1 KO plasmidhTOP2B gRNA2 KO plasmid
gRNA sequence CGGCAACGGGGCACTGACCTGGG(85,0.68),CGCGCCGCAGCCACCCGACTTGG(75,0.65)
Gene hTOP2B
Gene ID 7155
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.