Home / Products /Genome Editing /gRNA plasmids /hTMEM165 gRNA1 KO plasmidhTMEM165 gRNA2 KO plasmid

hTMEM165 gRNA1 KO plasmidhTMEM165 gRNA2 KO plasmid

Catalog Number: GP03828

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTMEM165 gRNA1 KO plasmidhTMEM165 gRNA2 KO plasmid
gRNA sequence TCCAGGGAACGGCCGCGCATCGG(97,0.76),GAACAAAGAACCGCCGGCGCCGG(95,0.69)
Gene hTMEM165
Gene ID 55858
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.