Home / Products /Genome Editing /gRNA plasmids /hTMEM140 gRNA1 KO plasmidhTMEM140 gRNA2 KO plasmidhTMEM140 gRNA3 KO plasmid

hTMEM140 gRNA1 KO plasmidhTMEM140 gRNA2 KO plasmidhTMEM140 gRNA3 KO plasmid

Catalog Number: GP03831

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTMEM140 gRNA1 KO plasmidhTMEM140 gRNA2 KO plasmidhTMEM140 gRNA3 KO plasmid
gRNA sequence AGCAGCTGGTCGCGCCACCGAGG(95,0.73),GGCAGATGACCACAATCACGAGG(90,0.65),GTTTTACGCTCTTCTCTGGGAGG(73,0.72)
Gene hTMEM140
Gene ID 55281
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.