Home / Products /Genome Editing /gRNA plasmids /hTM9SF4 gRNA1 KO plasmidhTM9SF4 gRNA2 KO plasmid

hTM9SF4 gRNA1 KO plasmidhTM9SF4 gRNA2 KO plasmid

Catalog Number: GP03839

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTM9SF4 gRNA1 KO plasmidhTM9SF4 gRNA2 KO plasmid
gRNA sequence AAGTTGATAGGCGCGACCCCAGG(99,0.7),TTTCTACGGGATCGTTCTGGTGG(95,0.78)
Gene hTM9SF4
Gene ID 9777
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.