Home / Products /Genome Editing /gRNA plasmids /hTLR3 gRNA1 KO plasmidhTLR3 gRNA2 KO plasmid

hTLR3 gRNA1 KO plasmidhTLR3 gRNA2 KO plasmid

Catalog Number: GP03842

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTLR3 gRNA1 KO plasmidhTLR3 gRNA2 KO plasmid
gRNA sequence TACCTTGTGAAGTTGGCGGCTGG(87,0.69),GTTGAGATAGCTCATTGTGCTGG(86,0.72)
Gene hTLR3
Gene ID 7098
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.