Home / Products /Genome Editing /gRNA plasmids /hTLE1 gRNA1 KO plasmidhTLE1 gRNA2 KO plasmid

hTLE1 gRNA1 KO plasmidhTLE1 gRNA2 KO plasmid

Catalog Number: GP06656

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTLE1 gRNA1 KO plasmidhTLE1 gRNA2 KO plasmid
gRNA sequence TTAATCCGGTCCAGGGACTCCGG(85,0.66),GCCCTTCAAGTTCACTATCCCGG(83,0.71)
Gene hTLE1
Gene ID 7088
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.