Home / Products /Genome Editing /gRNA plasmids /hTBL1X gRNA1 KO plasmidhTBL1X gRNA2 KO plasmidhTBL1X gRNA3 KO plasmid

hTBL1X gRNA1 KO plasmidhTBL1X gRNA2 KO plasmidhTBL1X gRNA3 KO plasmid

Catalog Number: GP06690

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTBL1X gRNA1 KO plasmidhTBL1X gRNA2 KO plasmidhTBL1X gRNA3 KO plasmid
gRNA sequence CAATGGGACGCTAGTGCCACCGG(88,0.68),TCTCGGCCTCTACATACTGCAGG(88,0.85),TCCCAAACGTGAAAGCCGAGTGG(76,0.69)
Gene hTBL1X
Gene ID 6907
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.