Home / Products /Genome Editing /gRNA plasmids /hTAB1 gRNA1 KO plasmidhTAB1 gRNA2 KO plasmid

hTAB1 gRNA1 KO plasmidhTAB1 gRNA2 KO plasmid

Catalog Number: GP03904

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTAB1 gRNA1 KO plasmidhTAB1 gRNA2 KO plasmid
gRNA sequence ATCAGCAGAGTAGCTGCGGTTGG(82,0.66),AACTTGAGCCAGCTGTCCTCTGG(78,0.74)
Gene hTAB1
Gene ID 10454
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.