Home / Products /Genome Editing /gRNA plasmids /hSURF6 gRNA1 KO plasmidhSURF6 gRNA2 KO plasmidhSURF6 gRNA3 KO plasmid

hSURF6 gRNA1 KO plasmidhSURF6 gRNA2 KO plasmidhSURF6 gRNA3 KO plasmid

Catalog Number: GP03913

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSURF6 gRNA1 KO plasmidhSURF6 gRNA2 KO plasmidhSURF6 gRNA3 KO plasmid
gRNA sequence CTGCTGTTCCGGGGCCGAATGGG(96,0.69),GGCGTCCTTGGCGAGTAGAGAGG(91,0.77),GCACAAGGCCAAGTCCTTGGGGG(64,0.81)
Gene hSURF6
Gene ID 6838
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.