Home / Products /Genome Editing /gRNA plasmids /hSTX17 gRNA1 KO plasmidhSTX17 gRNA2 KO plasmidhSTX17 gRNA3 KO plasmid

hSTX17 gRNA1 KO plasmidhSTX17 gRNA2 KO plasmidhSTX17 gRNA3 KO plasmid

Catalog Number: GP07079

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSTX17 gRNA1 KO plasmidhSTX17 gRNA2 KO plasmidhSTX17 gRNA3 KO plasmid
gRNA sequence GATAGTAATCCCAACAGACCTGG(78,0.65),TCTGGATAGCTGGTTCAAGACGG(75,0.76),CATGAAGAGCATATCAATGCAGG(77,0.68)
Gene hSTX17
Gene ID 55014
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.