Home / Products /Genome Editing /gRNA plasmids /hSTK16 gRNA1 KO plasmidhSTK16 gRNA2 KO plasmid

hSTK16 gRNA1 KO plasmidhSTK16 gRNA2 KO plasmid

Catalog Number: GP03943

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSTK16 gRNA1 KO plasmidhSTK16 gRNA2 KO plasmid
gRNA sequence GCGCTGTGTGTCTGCTCTCGGGG(79,0.74),CTAGTGGAAGGGTTACATGATGG(77,0.75)
Gene hSTK16
Gene ID 8576
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.