Home / Products /Genome Editing /gRNA plasmids /hSPAG7 gRNA1 KO plasmidhSPAG7 gRNA2 KO plasmid

hSPAG7 gRNA1 KO plasmidhSPAG7 gRNA2 KO plasmid

Catalog Number: GP06202

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSPAG7 gRNA1 KO plasmidhSPAG7 gRNA2 KO plasmid
gRNA sequence CTCCTCTCGATCTTGTTCATTGG(83,0.72),TCAGATTTCATTCAAGACAGTGG(63,0.65)
Gene hSPAG7
Gene ID 9552
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.