Home / Products /Genome Editing /gRNA plasmids /hSMAD3 gRNA1 KO plasmidhSMAD3 gRNA2 KO plasmidhSMAD3 gRNA3 KO plasmid

hSMAD3 gRNA1 KO plasmidhSMAD3 gRNA2 KO plasmidhSMAD3 gRNA3 KO plasmid

Catalog Number: GP04024

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSMAD3 gRNA1 KO plasmidhSMAD3 gRNA2 KO plasmidhSMAD3 gRNA3 KO plasmid
gRNA sequence AGCAGGCGCTTCACGATCGGGGG(98,0.78),CTTGGTGTTGACGTTCTGCGTGG(91,0.8),GAAGGGCGAGCAGAACGGGCAGG(78,0.73)
Gene hSMAD3
Gene ID 4088
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.