Home / Products /Genome Editing /gRNA plasmids /hSLC43A3 gRNA1 KO plasmidhSLC43A3 gRNA2 KO plasmidhSLC43A3 gRNA3 KO plasmid

hSLC43A3 gRNA1 KO plasmidhSLC43A3 gRNA2 KO plasmidhSLC43A3 gRNA3 KO plasmid

Catalog Number: GP04043

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC43A3 gRNA1 KO plasmidhSLC43A3 gRNA2 KO plasmidhSLC43A3 gRNA3 KO plasmid
gRNA sequence GGCCGATTGGCAATGCCACAGGG(89,0.71),TTGCTGGCGTCCTCTTTGGCTGG(82,0.72),GATCTGTGTGGACCAGATGCTGG(79,0.75)
Gene hSLC43A3
Gene ID 29015
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.