Home / Products /Genome Editing /gRNA plasmids /hSLC30A1 gRNA1 KO plasmidhSLC30A1 gRNA2 KO plasmidhSLC30A1 gRNA3 KO plasmid

hSLC30A1 gRNA1 KO plasmidhSLC30A1 gRNA2 KO plasmidhSLC30A1 gRNA3 KO plasmid

Catalog Number: GP06587

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC30A1 gRNA1 KO plasmidhSLC30A1 gRNA2 KO plasmidhSLC30A1 gRNA3 KO plasmid
gRNA sequence GTTCGGCTGGATCCGAGCCGAGG(96,0.89),GGAGAGCATCGCCAGCGACGAGG(93,0.77),GCTGTCGGACGTGCTGGCGCTGG(81,0.79)
Gene hSLC30A1
Gene ID 7779
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.