Home / Products /Genome Editing /gRNA plasmids /hSLC27A5 gRNA1 KO plasmidhSLC27A5 gRNA2 KO plasmidhSLC27A5 gRNA3 KO plasmid

hSLC27A5 gRNA1 KO plasmidhSLC27A5 gRNA2 KO plasmidhSLC27A5 gRNA3 KO plasmid

Catalog Number: GP08175

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC27A5 gRNA1 KO plasmidhSLC27A5 gRNA2 KO plasmidhSLC27A5 gRNA3 KO plasmid
gRNA sequence CGCTCGTGCTCGCCGCTCGAAGG(99,0.69),CCAAGTAGCACGCAACATGTGGG(94,0.68),GCCGGCAGCCAGCGTAGTCCTGG(90,0.73)
Gene hSLC27A5
Gene ID 10998
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.