Home / Products /Genome Editing /gRNA plasmids /hSHC3 gRNA1 KO plasmidhSHC3 gRNA2 KO plasmidhSHC3 gRNA3 KO plasmid

hSHC3 gRNA1 KO plasmidhSHC3 gRNA2 KO plasmidhSHC3 gRNA3 KO plasmid

Catalog Number: GP07159

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSHC3 gRNA1 KO plasmidhSHC3 gRNA2 KO plasmidhSHC3 gRNA3 KO plasmid
gRNA sequence TGCGCAAGGCGCCCGACGATGGG(99,0.65),TCCCTACTTGGTGTCCGGCGAGG(96,0.74),AAGCGGTTATACTTGGTGCGTGG(93,0.75)
Gene hSHC3
Gene ID 53358
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.