Home / Products /Genome Editing /gRNA plasmids /hSH3GL1 gRNA1 KO plasmidhSH3GL1 gRNA2 KO plasmid

hSH3GL1 gRNA1 KO plasmidhSH3GL1 gRNA2 KO plasmid

Catalog Number: GP06804

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSH3GL1 gRNA1 KO plasmidhSH3GL1 gRNA2 KO plasmid
gRNA sequence CAAGGCGGTGACAGAAGTGCTGG(76,0.64),CATGGTCAGCTTAGCCCGCGAGG(67,0.71)
Gene hSH3GL1
Gene ID 6455
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.