Home / Products /Genome Editing /gRNA plasmids /hSH2B2 gRNA1 KO plasmidhSH2B2 gRNA2 KO plasmidhSH2B2 gRNA3 KO plasmid

hSH2B2 gRNA1 KO plasmidhSH2B2 gRNA2 KO plasmidhSH2B2 gRNA3 KO plasmid

Catalog Number: GP08237

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSH2B2 gRNA1 KO plasmidhSH2B2 gRNA2 KO plasmidhSH2B2 gRNA3 KO plasmid
gRNA sequence CTCCACTGCTGGGATGATAGCGG(74,0.78),CCATGGGCAGGACAATAGCTTGG(72,0.67),GCCAGAGAGGGTCCTGAGATGGG(66,0.64)
Gene hSH2B2
Gene ID 10603
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.