Home / Products /Genome Editing /gRNA plasmids /hSETD1B gRNA1 KO plasmidhSETD1B gRNA2 KO plasmidhSETD1B gRNA3 KO plasmid

hSETD1B gRNA1 KO plasmidhSETD1B gRNA2 KO plasmidhSETD1B gRNA3 KO plasmid

Catalog Number: GP07849

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSETD1B gRNA1 KO plasmidhSETD1B gRNA2 KO plasmidhSETD1B gRNA3 KO plasmid
gRNA sequence TGGTTCCTCCTCTCGCCCGAAGG(93,0.67),GATTGACCCGGCTCTGAAAAAGG(85,0.7),TGAAATGCTGCCCATCGTAGCGG(80,0.73)
Gene hSETD1B
Gene ID 23067
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.