Home / Products /Genome Editing /gRNA plasmids /hSCAND1 gRNA1 KO plasmidhSCAND1 gRNA2 KO plasmidhSCAND1 gRNA3 KO plasmid

hSCAND1 gRNA1 KO plasmidhSCAND1 gRNA2 KO plasmidhSCAND1 gRNA3 KO plasmid

Catalog Number: GP07232

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSCAND1 gRNA1 KO plasmidhSCAND1 gRNA2 KO plasmidhSCAND1 gRNA3 KO plasmid
gRNA sequence TTTCTCCGGTGGCACCGCCGCGG(96,0.91),GGCGGCTACGGAGCCGATCTTGG(94,0.78),CTCAGGGGCTGAGCTCGAACCGG(89,0.71)
Gene hSCAND1
Gene ID 51282
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.