Home / Products /Genome Editing /gRNA plasmids /hSCAF11 gRNA1 KO plasmidhSCAF11 gRNA2 KO plasmid

hSCAF11 gRNA1 KO plasmidhSCAF11 gRNA2 KO plasmid

Catalog Number: GP06264

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSCAF11 gRNA1 KO plasmidhSCAF11 gRNA2 KO plasmid
gRNA sequence CCAATTCCAGGTAATGTATCAGG(83,0.65),AATCAATGCACTGATTTCACTGG(65,0.69)
Gene hSCAF11
Gene ID 9169
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.