Home / Products /Genome Editing /gRNA plasmids /hSAMD9L gRNA1 KO plasmidhSAMD9L gRNA2 KO plasmidhSAMD9L gRNA3 KO plasmid

hSAMD9L gRNA1 KO plasmidhSAMD9L gRNA2 KO plasmidhSAMD9L gRNA3 KO plasmid

Catalog Number: GP07897

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSAMD9L gRNA1 KO plasmidhSAMD9L gRNA2 KO plasmidhSAMD9L gRNA3 KO plasmid
gRNA sequence TGTAGAAATGGGGCTACCATGGG(84,0.75),CATCTTAATGTCCACTTCCGTGG(81,0.82),TACATTGAAGTGGTCAATGAAGG(76,0.69)
Gene hSAMD9L
Gene ID 219285
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.