Home / Products /Genome Editing /gRNA plasmids /hRTN4RL2 gRNA1 KO plasmidhRTN4RL2 gRNA2 KO plasmidhRTN4RL2 gRNA3 KO plasmid

hRTN4RL2 gRNA1 KO plasmidhRTN4RL2 gRNA2 KO plasmidhRTN4RL2 gRNA3 KO plasmid

Catalog Number: GP04191

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hRTN4RL2 gRNA1 KO plasmidhRTN4RL2 gRNA2 KO plasmidhRTN4RL2 gRNA3 KO plasmid
gRNA sequence ACAACCTCATCCGCACGCTGCGG(92,0.65),TTGGCCTGGCAGCTCACGGTGGG(81,0.68),CAGGAAGAGTCGCTGAGTGCTGG(63,0.7)
Gene hRTN4RL2
Gene ID 349667
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.