Home / Products /Genome Editing /gRNA plasmids /hRSAD2 gRNA1 KO plasmidhRSAD2 gRNA2 KO plasmidhRSAD2 gRNA3 KO plasmid

hRSAD2 gRNA1 KO plasmidhRSAD2 gRNA2 KO plasmidhRSAD2 gRNA3 KO plasmid

Catalog Number: GP04194

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hRSAD2 gRNA1 KO plasmidhRSAD2 gRNA2 KO plasmidhRSAD2 gRNA3 KO plasmid
gRNA sequence GCCTGGTCCCGCTGTTCTGCTGG(80,0.65),TCTGGCTGCTAGCTACCAAGAGG(79,0.76),AGGGCCAGATGAGACCAAAGAGG(62,0.72)
Gene hRSAD2
Gene ID 91543
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.