Home / Products /Genome Editing /gRNA plasmids /hRMC1 gRNA1 KO plasmidhRMC1 gRNA2 KO plasmidhRMC1 gRNA3 KO plasmid

hRMC1 gRNA1 KO plasmidhRMC1 gRNA2 KO plasmidhRMC1 gRNA3 KO plasmid

Catalog Number: GP02104

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hRMC1 gRNA1 KO plasmidhRMC1 gRNA2 KO plasmidhRMC1 gRNA3 KO plasmid
gRNA sequence TCTAACACCGGTTCGCGCAT,ACTAGCACCTCTTGTCAGAG
Gene hRMC1
Gene ID 29919
Fluorescence/resistance EGFP/puro
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.