Home / Products /Genome Editing /gRNA plasmids /hRAP1GDS1 gRNA1 KO plasmidhRAP1GDS1 gRNA2 KO plasmid

hRAP1GDS1 gRNA1 KO plasmidhRAP1GDS1 gRNA2 KO plasmid

Catalog Number: GP06892

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hRAP1GDS1 gRNA1 KO plasmidhRAP1GDS1 gRNA2 KO plasmid
gRNA sequence AGTGCTGCTTCAAACGGGCAGGG(90,0.68),CGAATTCCATGTGTGGATGCTGG(74,0.7)
Gene hRAP1GDS1
Gene ID 5910
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.