Home / Products /Genome Editing /gRNA plasmids /hRAB5A gRNA1 KO plasmidhRAB5A gRNA2 KO plasmid

hRAB5A gRNA1 KO plasmidhRAB5A gRNA2 KO plasmid

Catalog Number: GP04278

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hRAB5A gRNA1 KO plasmidhRAB5A gRNA2 KO plasmid
gRNA sequence CGAGGCGCAACAAGACCCAACGG(90,0.66),CTTCTGGGAGAGTCCGCTGTTGG(86,0.83)
Gene hRAB5A
Gene ID 5868
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.